Article Figures & Data
Figures
- FIGURE 1.
Patient 1, 73-y-old man with 2.8 × 2.8 cm lung adenocarcinoma. (A) CT scan shows nodule in right lung. (B) Early 99mTc-MIBI SPECT scan (left) shows intense uptake (arrow) of 99mTc-MIBI in tumor (L/Ne = 3.81). Delayed scan (right) shows faint 99mTc-MIBI uptake in tumor (L/Nd = 1.00), suggesting rapid washout of 99mTc-MIBI from tumor (L/Nwr = 73.8%). Immunohistochemistry (×200) reveals strong Pgp expression (C), strong MRP expression (D), and weak LRP expression (E) in corresponding tumor tissue.
- FIGURE 2.
Patient 34, 68-y-old woman with 3.6 × 3.6 cm lung adenocarcinoma. (A) CT scan shows nodule in right lung. (B) Early 99mTc-MIBI SPECT scan (left) shows intense uptake of 99mTc-MIBI in tumor (L/Ne = 3.65). Delayed scan (right) also shows intense 99mTc-MIBI uptake in tumor (L/Nd = 5.17), suggesting slow washout of 99mTc-MIBI from tumor (L/Nwr = −41.6%). Immunohistochemistry (×200) reveals negative Pgp expression (C), negative MRP expression (D), and strong LRP expression (E) in corresponding tumor tissue.
- FIGURE 3.
Relationship between expression of Pgp, MRP, or LRP and 99mTc-MIBI L/Nd in lung cancer. (A) L/Nd correlated inversely with density of Pgp expression. Statistically significant difference in L/Nd was found between Pgp (−) group and Pgp (++) group. (B) No significant difference (n.s.) in L/Nd was found among MRP (++), MRP (+), and MRP (−) groups. (C) No significant difference in L/Nd was found among LRP (++), LRP (+), and LRP (−) groups.
- FIGURE 4.
Relationship between expression of Pgp, MRP, or LRP and 99mTc-MIBI L/Nwr in lung cancer. (A) L/Nwr correlated with density of Pgp expression. Statistically significant difference in L/Nwr was found between Pgp (++) group and Pgp (−) group. (B) No significant difference (n.s.) in L/Nwr was found among MRP(++), MRP (+), and MRP (−) groups. (C) No significant difference in L/Nwr was found among LRP (++), LRP (+), and LRP (−) groups.
- FIGURE 5.
Relationship between Pgp mRNA expression and 99mTc-MIBI L/Nd or 99mTc-MIBI L/Nwr in lung cancer. (A) L/Nd correlated inversely with Pgp mRNA level. Statistically significant difference in L/Nd was found between Pgp mRNA low-expression group and Pgp mRNA high-expression group. (B) Statistical support was found toward a significant difference in L/Nwr between Pgp mRNA high-expression group and Pgp mRNA low-expression group.
Tables
Gene Quantification method Sequence cDNA MDR1 Forward primer 5′CCCAGGAGCCCATCCTGT3′ 3774-3791 Reverse primer 5′CCCGGCTGTTGTCTCCATA3′ 3838-3821 Probe 5′(FAM)TGACTGCAGCATTGCTGAGAACATTGC(TAMRA)3′ 3793-3819 MRP Forward primer 5′AAGCGCCTCGAGTCGGT3′ 3617-3633 Reverse primer 5′TCGAATGACGCTGACCCC3′ 3694-3677 Probe 5′(FAM)AGCCGCTCCCCGGTCTATTCCC(TAMRA)3′ 3635-3656 LRP Forward primer 5′TTTCGATGACTTCCATAAGAACTCA3′ 1881-1905 Reverse primer 5′TTCCGAGGTCTCAAAGCCAA3′ 1950-1931 Probe 5′(FAM)CCCGCATCATTCGCACTGCTGT(TAMRA)3′ 1907-1928 GAPDH Forward primer 5′GAAGGTGAAGGTCGGAGTCA3′ Reverse primer 5′GAAGATGGTGATGGGA3′ Probe 5′(JOE)CAAGCTTCCCGTTCTCAGCC(TAMRA)3′ Patient no. Age (y) Sex Histology Tumor size (cm) 99mTc-MIBI SPECT Immunohistochemistry RT PCR L/Ne L/Nd L/Nwr (%) Pgp MRP LRP MDR1 MRP LRP 1 73 M ADE 2.8 3.81 1.00 73.8 ++ ++ + 0.5435 0.0028 0.0784 2 59 M Meta 2.6 1.52 1.00 34.2 ++ + ++ — — — 3 37 M Large 7.0 2.18 1.35 38.1 ++ + + — — — 4 62 F ADE 2.2 1.77 1.00 43.5 ++ + ++ — — — 5 72 F ADE 1.9 1.16 1.00 13.8 ++ − ++ — — — 6 56 M ADE 1.0 1.00 1.00 NA ++ − ++ 0.0707 0.0004 0.2489 7 60 M ADE 5.5 1.00 1.00 NA + ++ + 0.0914 0.1750 0.1643 8 70 M Small 5.0 1.3 1.48 −13.8 + ++ + — — — 9 82 M ADE 3.4 2.15 3.18 −47.9 + ++ ++ 0.0035 0.0448 0.1035 10 74 M ADE 3.2 1.93 2.58 −33.7 + ++ + 0.0019 0.0096 0.1386 11 74 M ADE 2.7 1.88 1.70 9.6 + + + 0.0427 0.1623 0.0976 12 78 M ADESQ 1.8 2.78 1.00 64.0 + + ++ 0.0489 0.0277 0.0236 13 64 F ADE 1.6 1.78 1.00 43.8 + + ++ — — — 14 66 M ADE 2.5 1.85 2.21 −19.5 + + ++ 0.1082 0.0686 1.2370 15 58 M ADE 1.5 1.00 1.00 NA + + ++ — — — 16 72 M ADE 2.3 1.00 1.00 NA + + + — — — 17 72 M Meta 1.5 1.00 1.00 NA + + − — — — 18 74 F ADE 2.8 2.03 1.97 3.0 + + ++ — — — 19 72 F ADE 1.2 1.00 1.00 NA + − ++ — — — 20 58 F ADE 2.8 1.00 1.00 NA + − + — — — 21 66 M ADE 2.8 3.99 2.37 40.6 − ++ ++ — — — 22 81 M SCC 3.0 2.29 4.10 −79.0 − + + — — — 23 72 M ADE 2.1 1.61 1.97 −22.4 − + ++ — — — 24 70 M ADESQ 2.5 1.57 1.42 9.6 − + ++ — — — 25 66 F ADE 2.6 1.36 1.78 −30.9 − + + — — — 26 78 M ADE 4.0 1.33 1.54 −15.8 − + ++ 0.0027 0.0045 0.0125 27 73 M SCC 2.7 2.09 1.45 30.0 − + + — — — 28 76 M ADE 4.0 3.37 2.98 11.6 − + − 0.0278 0.0283 0.0409 29 76 M ADE 1.8 1.92 1.74 9.4 − + + — — — 30 75 M SCC 3.2 2.80 1.84 34.3 − + + — — — 31 66 M SCC 2.5 1.00 1.00 NA − + − — — — 32 79 M Small 2.2 2.50 1.94 22.4 − + − — — — 33 72 M SCC 2.8 1.63 1.25 23.3 − − − — — — 34 68 F ADE 3.6 3.65 5.17 −41.6 − − ++ — — — ADE = adenocarcinoma; Meta = metastatic lung tumor; Large = large cell carcinoma; NA = not applicable; small = small cell carcinoma; ADESQ = adenosquamous cell carcinoma; SCC = squamous cell carcinoma.
In this issue
Jump to section
Related Articles
Cited By...
- Retention of the Radiotracers 64Cu-ATSM and 64Cu-PTSM in Human and Murine Tumors Is Influenced by MDR1 Protein Expression
- Detection of P-Glycoprotein Activity in Endotoxemic Rats by 99mTc-Sestamibi Imaging
- Usefulness of 99mTc-Sestamibi Scintigraphy in Suggesting the Therapeutic Effect of Chemotherapy against Gastric Cancer
- 99mTc-MIBI Imaging as a Predictor of Therapy Response in Osteosarcoma Compared with Multidrug Resistance-Associated Protein and P-Glycoprotein Expression